antisense oligomer, pharmaceutical composition use of an antisense oligomer or a pharmaceutically ac

专利摘要:
ANTISENTED OLIGOMER, PHARMACEUTICAL COMPOSITION, USE OF AN ANTISENTED OLIGOMER OR A PHARMACEUTICALLY ACCEPTABLE SALT OR HYDRATE OF THE SAME, AND METHODS FOR MANUFACTURING AND FOR SCREENING AN ANTISENTED OLIGOMER. A drug that provides highly efficient exon leap is provided. The present invention provides an antisense oligomer having at least two unit oligomers that target networks that are neither continuous nor overlapping in the same exon.
公开号:BR112016029369B1
申请号:R112016029369-0
申请日:2015-06-16
公开日:2020-12-08
发明作者:Naoki Watanabe；Yuuichirou TONE；Shin'ichi Takeda；Tetsuya Nagata
申请人:Nippon Shinyaku Co., Ltd.；National Center Of Neurology And Psychiatry；
IPC主号:

专利说明:

TECHNICAL FIELD
[001] The present invention relates to an antisense oligomer for skipping the exon, comprising a nucleotide sequence complementary to two or more different sequences in a target exon. More specifically, the present invention relates to an antisense oligomer that causes exon 44 to jump in the human dystrophin gene, and a pharmaceutical composition comprising the oligomer.
[002] Duchenne muscular dystrophy (DMD) is the most frequent form of hereditary progressive muscular dystrophy that affects one in about 3,500 newborn boys. Although motor functions are rarely different from healthy humans in infancy and childhood, muscle weakness is seen in children around 4 to 5 years of age. Then, muscle weakness progresses to the loss of ambulation at about 12 years of age and death due to heart or respiratory failure at the early twenties. DMD is a severe disorder like this. Currently, there is no effective therapy for DMD available and it is strongly desired to develop an unprecedented therapeutic agent.
[003] DMD is known to be caused by a mutation in the dystrophin gene. The dystrophin gene is located on the X chromosome and is a huge gene that consists of 2.2 million pairs of DNA nucleotides. DNA is transcribed into the mRNA precursors and introns are removed by RNA processing to synthesize 13,993-base mRNA, in which 79 exons are joined. This mRNA is translated into 3,685 amino acids to produce the dystrophin protein. Dystrophin protein is associated with maintaining membrane stability in muscle cells and is necessary to make muscle cells less fragile. The dystrophin gene in patients with DMD contains a mutation and thus the dystrophin protein, which is functional in muscle cells, is rarely expressed. Thus, the structure of muscle cells cannot be maintained in the body of patients with DMD, leading to a large influx of calcium ions into muscle cells. Consequently, an inflammation-like response occurs to promote fibrosis, so that muscle cells can be regenerated only with difficulty.
[004] Becker muscular dystrophy (BMD) is also caused by a mutation in the dystrophin gene. Symptoms involve muscle weakness, but are typically mild and slow in progressing muscle weakness when compared to DMD. In many cases, its onset is in adulthood. Differences in clinical symptoms between DMD and BMD are considered to lie in whether the reading frame for amino acids in the translation of dystrophin mRNA into the dystrophin protein is interrupted by the mutation or not (Non-Patent Document 1). More specifically, in DMD, the presence of a mutation displaces the reading frame of the amino acid, in such a way that the expression of the functional dystrophin protein is abolished, while in BMD the dystrophin protein that works, although imperfectly, is produced due to the reading frame of the amino acid is preserved, although part of the exons is removed by the mutation.
[005] Exon hopping is expected to serve as a method to treat DMD. This method involves modifying the RNA processing to restore the reading frame of the dystrophin mRNA amino acid and induce the expression of the dystrophin protein with the function partially restored (Non-Patent Document 2). The portion of the amino acid sequence, which is a target for jumping the exon, will be lost. For this reason, the dystrophin protein expressed by this treatment is less than normal, but, once the amino acid reading frame is maintained, the function to stabilize muscle cells is partially retained. Consequently, exon leap is expected to lead DMD to symptoms similar to those of BMD, which are milder. The exon leap approach has passed animal testing using mice or dogs and is now being evaluated in clinical experiments on human DMD patients.
[006] An exon bounce can be induced by linking antisense nucleic acids that target either 5 'or 3' RNA processing site or both sites, or internal exon sites. An exon will only be included in the mRNA when both sites of RNA processing in it are recognized by the spliceosome complex. Thus, exon skipping can be induced by targeting RNA processing sites with antisense nucleic acids. Furthermore, the binding of an SR protein, which is rich in serine and arginine, to an exon RNA processing enhancer (ESE) is considered necessary for an exon to be recognized by the RNA processing mechanism. In this way, exon jump can also be induced by the targeting ESE.
[007] Since a dystrophin gene mutation can vary depending on patients with DMD, antisense nucleic acids need to be designed based on the site or type of the respective genetic mutation. There are many reports of antisense nucleic acids that induce exon jump with a consecutive sequence as a target for a single exon in the dystrophin gene (Patent Documents 1 to 6 and Non-Patent Documents 1 and 2). Also, it has been reported that when two types of antisense nucleic acids that target the same exon in the dystrophin gene are mixed and act naturally (double targeting), jumping activity can be improved, compared with using each antisense nucleic acid alone ( Patent Document 7).
[008] However, none of the previous reports shows that a single-stranded antisense nucleic acid (connected type) that targets two or more sites in the same exon exhibits jumping activity (Patent Document 1). BACKGROUND DOCUMENT Patent Document Patent Document 1: International Patent Application WO 2004/048570 Patent Document 2: International Patent Application WO 2009/139630 Patent Document 3: International Patent Application WO 2010/048586 Patent Document 4: US 2010/0168212 Patent Document 5: International Patent Application WO 2011/057350 Patent Document 6: International Patent Application WO 2006/000057 Patent Document 7: International Patent Application WO 2007/135105 Non-Patent Document Non-Patent Document 1: Annemieke Aartsma-Rus et al ., (2002) Neuromuscular Disorders 12: S71-S77 Non-Patent Document 2: Wilton SD, et al., Molecular Therapy 2007: 15: p. 1288-96 DESCRIPTION OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION
[009] Under these circumstances, a main objective of the present invention is to provide an unprecedented connected type antisense oligomer that induces exon jump by targeting two different nucleotide sequences in the same exon in the dystrophin gene, and a therapeutic agent for muscular dystrophy comprising the oligomer. MEANS TO SOLVE THE PROBLEM
[0010] The present inventors conducted comprehensive studies of the content of the techniques described in the documents described above and the structure of the dystrophin gene, etc. and, consequently, they found that an antisense oligomer obtained by connecting oligomers that target two different sites in exon 44 in the human dystrophin gene can induce the jump of this exon. Based on this discovery, the present inventors have completed the present invention.
That is, the present invention is as follows. [1] An antisense oligomer having a length of 15 to 30 bases in which (a) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (b) a second unit oligomer comprising a nucleotide sequence complementary to a second sequence of 7 to 15 consecutive nucleotides in the target exon are connected, wherein the first nucleotide sequence and the second nucleotide sequence are neither consecutive nor overlaps one another, and the antisense oligomer induces leap from the target exon, or a pharmaceutically acceptable salt or hydrate from it. [2] The antisense oligomer according to [1], wherein the first and / or second unit oligomer comprises a nucleotide sequence complementary to a partial nucleotide sequence of an intron adjacent to the target exon, or a pharmaceutically acceptable salt or hydrate the same. [3] The antisense oligomer according to [1] or [2], wherein the target exon is an exon in a human dystrophin gene, or a pharmaceutically acceptable salt or hydrate thereof. [4] The antisense oligomer according to [1] or [2], wherein the first nucleotide sequence is a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 1, or one pharmaceutically acceptable salt or hydrate thereof. [5] The antisense oligomer according to any one of [1] to [3], wherein the second nucleotide sequence is a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 2 , or a pharmaceutically acceptable salt or hydrate thereof. [6] The antisense oligomer according to [1] or [2], in which two unit oligomers selected from the group consisting of the following (c) to (e) are connected: (c) a unit oligomer consisting of a sequence nucleotide complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 3; (d) a unitary oligomer consisting of a nucleotide sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 4; and (e) a unitary oligomer consisting of a nucleotide sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 5, or a pharmaceutically acceptable salt or hydrate thereof. [7] The antisense oligomer according to [1] or [2], which consists of a nucleotide sequence selected from a group consisting of SEQ ID Nos: 6 to 9, or a pharmaceutically acceptable salt or hydrate thereof. [8] The antisense oligomer according to any one of [1] to [7], which is an oligonucleotide, or a pharmaceutically acceptable salt or hydrate thereof. [9] The antisense oligomer according to [8], wherein the sugar fraction and / or the phosphate-binding region of at least one nucleotide that constitutes the oligonucleotide is modified, or a pharmaceutically acceptable salt or hydrate thereof. [10] The antisense oligomer according to [8] or [9], in which the sugar fraction of at least one nucleotide that constitutes the oligonucleotide is a ribose in which the 2'-OH group is replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br and I (where R is an alkyl or an aryl and R 'is an alkylene) , or a pharmaceutically acceptable salt or hydrate thereof. [11] The antisense oligomer according to any one of [8] to [10], wherein the phosphate binding region of at least one nucleotide that constitutes the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond , a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond and a boranophosphate bond, or a pharmaceutically acceptable salt or hydrate thereof. [12] The antisense oligomer according to any one of [1] to [7], which is a morpholino oligomer, or a pharmaceutically acceptable salt or hydrate thereof. [13] The antisense oligomer according to claim [12], which is a morpholino oligomer, or a pharmaceutically acceptable salt or hydrate thereof. [14] The antisense oligomer according to [12] or [13], wherein the 5 'end is any of the chemical formulas (1) to (3) below, or a pharmaceutically acceptable salt or hydrate thereof. [Formula 1]
[15] A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active ingredient the antisense oligomer according to any one of [1] to [14], or a pharmaceutically acceptable salt or hydrate thereof. [16] The pharmaceutical composition according to [15], comprising a pharmaceutically acceptable carrier. [17] A method for the treatment of muscular dystrophy, which comprises providing a patient with muscular dystrophy with the antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof according to any of [1] to [12] or the pharmaceutical composition according to [1] or [16]. [18] The treatment method according to [17], in which the patient with muscular dystrophy has a mutation (s) that is to be directed to exon 44 that bounces on the gistrophin gene. [19] The method for treatment according to [17] or [18], in which the patient is a human. [20] The use of the antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [14] in the manufacture of the pharmaceutical composition for the treatment of muscular dystrophy. [21] The antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to any one of [1] to [14], which is applied for the treatment of muscular dystrophy. [22] The antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to [21] in which the patient with muscular dystrophy in said treatment has a mutation (s) that is to be directed to exon 44 that bounces in the gene gistrofina. [23] The antisense oligomer according to [21] or [22], or a pharmaceutically acceptable salt or hydrate thereof, in which the patient is a human. [24] A method for manufacturing the antisense oligomer according to [1], which comprises connecting (a) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (b) a second unit oligomer comprising a nucleotide sequence complementary to a second consecutive 7 to 15 base nucleotide sequence in the target exon to produce an antisense oligomer having a length of 15 to 30 bases, wherein the first nucleotide sequence and the second sequence of nucleotides are neither consecutive nor overlapping one another. [25] The method according to [24], which additionally comprises: measuring the jump efficiency by the obtained antisense oligomer; and selecting an antisense oligomer having the jump efficiency that exceeds a reference value. [26] A method for screening an antisense oligomer, comprising: (a) selecting (i) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (ii) a second unit oligomer comprising a nucleotide sequence complementary to a second sequence of 7 to 15 consecutive nucleotides in the target exon, where the first nucleotide sequence and the second nucleotide sequence are neither consecutive nor overlapping each other; (b) connecting the first and second unit oligomers to produce an antisense oligomer having a length of 15 to 30 bases; (c) measure the efficiency of the jump by the antisense oligomer obtained in step (b); and (d) selecting an antisense oligomer having the jump efficiency that exceeds a reference value. EFFECTS OF THE INVENTION
[0012] The antisense oligomer of the present invention can induce the exon 44 jump in the human dystrophin gene with high efficiency. Also, the symptoms of Duchenne muscular dystrophy can be effectively alleviated by administering the pharmaceutical composition of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIGURE 1 shows the efficiency of exon 44 jumping in the human dystrophin gene in a human rhabdomyosarcoma cell line (RD cells).
[0014] FIGURE 2 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0015] FIGURE 3 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0016] FIGURE 4 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0017] FIGURE 5 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0018] FIGURE 6 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0019] FIGURE 7 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0020] FIGURE 8 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0021] FIGURE 9 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0022] FIGURE 10 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0023] FIGURE 11 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0024] FIGURE 12 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0025] FIGURE 13 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0026] FIGURE 14 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0027] FIGURE 15 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0028] FIGURE 16 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0029] FIGURE 17 shows the efficiency of the exon 44 jump in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0030] FIGURE 18 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0031] FIGURE 19 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0032] FIGURE 20 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective oligomer concentrations.
[0033] FIGURE 21 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0034] FIGURE 22 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective concentrations of the oligomers.
[0035] FIGURE 23 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0036] FIGURE 24 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective oligomer concentrations.
[0037] FIGURE 25 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) in the respective concentrations of the oligomers.
[0038] FIGURE 26 shows the efficiency of exon 44 jumping in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) at the respective oligomer concentrations.
[0039] FIGURE 27 shows a comparison of the efficiency of the exon 44 hop in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) between a connected form and a mixture of two unitary oligomers that target different sites.
[0040] FIGURE 28 shows a comparison of the efficiency of the exon 44 hop in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) between a connected form and a mixture of two unitary oligomers that target different sites.
[0041] FIGURE 29 shows a comparison of the efficiency of the exon 44 hop in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) between a connected form and a mixture of two unitary oligomers that target different sites.
[0042] FIGURE 30 shows a comparison of the efficiency of the exon 44 hop in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) between each alone, a connected form and a mixture of two unitary oligomers that target different sites.
[0043] FIGURE 31 shows a comparison of the efficiency of the exon 44 hop in the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) between each alone, a connected form and a mixture of two unitary oligomers that target different sites.
[0044] FIGURE 32 shows the efficiency of the exon 44 jump in the human dystrophin gene in the fibroblasts of the patient with human DMD with exon 45 deletion. MODE FOR CARRYING OUT THE INVENTION
[0045] In the following, the present invention is described in detail. The modalities described below should be presented by way of example merely to describe the invention, but not limited to the following modalities only. The present invention can be implemented in several ways without departing from the essence of the invention.
[0046] All publications, published patent applications, patents and other documents cited in the patent application are hereby incorporated by reference in full. The descriptive report hereby incorporates by reference the contents of the descriptive report and drawings in the Japanese patent application (No. 2014-124157) filed on June 17, 2014, of which priority was claimed. 1. Anti-sense oligomer
[0047] The present invention provides an antisense oligomer having a length of 15 to 30 bases in which (a) a first unitary oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (b) a second unit oligomer comprising a nucleotide sequence complementary to a second sequence of 7 to 15 consecutive nucleotides in the target exon are connected, wherein the first nucleotide sequence and the second nucleotide sequence are neither consecutive nor overlaps one another, and the antisense oligomer induces leap from the target exon, or a pharmaceutically acceptable salt or hydrate from it. In the following, "an antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof" may be generically called "an antisense oligomer" collectively.
[0048] The antisense oligomer described above can be manufactured by a method for fabrication which comprises connecting (a) a first unitary oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (b) a second unit oligomer comprising a nucleotide sequence complementary to a second consecutive 7 to 15 base nucleotide sequence in the target exon to produce an antisense oligomer having a length of 15 to 30 bases, wherein the first nucleotide sequence and the second nucleotide sequence are neither consecutive nor overlapping one another.
[0049] The method for manufacturing may additionally comprise the step of measuring the jump efficiency by the obtained antisense oligomer, and a secondary step of selecting an antisense oligomer having the jump efficiency that exceeds a reference value.
[0050] In the secondary step of the manufacturing method described above, the jump efficiency can be determined as follows. The mRNA for the gene comprising the targeted exon is collected from the test cells; in mRNA, the level of polynucleotide "A" of the band where the directed exon is skipped and the level of polynucleotide "B" of the band where the directed exon is not skipped are measured. Using these measurement values from “A” and “B,” efficiency is calculated by the following equation: Jump efficiency (%) = A / (A + B) x 100
[0051] Alternatively, for the calculation of the jump efficiency, the international patent application WO2012 / 029986 can be referred.
[0052] In the secondary step, the jump efficiency used as the reference value is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more or 90% or more.
[0053] By connecting a plurality of unit oligomers, as mentioned earlier, an antisense oligomer having better jumping activity can be obtained even if each of the unit oligomers has low jumping activity (or no jumping activity).
[0054] The present invention also provides a method for screening an antisense oligomer, comprising: (a) selecting (i) a first unit oligomer comprising a nucleotide sequence complementary to a first nucleotide sequence of 7 to 15 consecutive bases in a target exon; and (ii) a second unit oligomer comprising a nucleotide sequence complementary to a second sequence of 7 to 15 consecutive nucleotides in the target exon, where the first nucleotide sequence and the second nucleotide sequence are neither consecutive nor overlapping each other; (b) connecting the first and second unit oligomers to produce an antisense oligomer having a length of 15 to 30 bases; (c) measure the efficiency of the jump by the antisense oligomer obtained in step (b); and (d) selecting an antisense oligomer having the jump efficiency that exceeds a reference value.
[0055] In the antisense oligomer described above, the first and second unit oligomers can be connected in a way where any of the first and second unit oligomers is positioned on the 5 'or 3' side of the other. In one embodiment, the first unit oligomer is positioned on the 5 'side, and the second unit oligomer is positioned on the 3' side for the connection.
[0056] Also, the antisense oligomer can comprise a third unit oligomer comprising a nucleotide sequence complementary to a third 7 to 15 consecutive base nucleotide sequence in the target exon.
[0057] As used herein, the term "connect" refers to one where the two unit oligomers are directly linked to each other or one where the two unit oligomers are linked to each other by means of a linker. When the two unit oligomers are directly attached to each other, then the 3 'end of the unit oligomer positioned on the 5' side and the 5 'end of the other unit oligomer positioned on the 3' side form a phosphate bond or a group shown below . Example of the linker includes a nucleic acid (strand) of 1 to 5 residues, as well as a known linker commonly used to connect nucleic acids or derivatives of nucleic acid morpholino, such as 3-aminopropyl, succinyl, 2,2'-diethanololsulfonyl and alkylamino long-chain (LCAA). [Formula 2]
where X represents -OH, -CH2R1, -O-CH2R1, -S-CH2R1, -NR2R3 or F; R1 represents H or an alkyl; R2 and R3, which can be the same or different, each represents H, an alkyl, a cycloalkyl or an aryl; Y1 represents O, S, CH2 or NR1; Y2 represents O, S or NR1; Z represents O or S.
[0058] The first and / or second unit oligomer can comprise a nucleotide sequence complementary to a partial nucleotide sequence of an intron adjacent to the target exon. In an embodiment in which, for example, the first and second unit oligomers are connected to each other in a manner where the first unit oligomer is positioned on the 5 'side and the second unit oligomer is positioned on the 3' side, the 5 side 'of the first unit oligomer can comprise a nucleotide sequence complementary to a nucleotide sequence that resides in the vicinity of the 3' end of an adjacent intron on the 5 'side of the target exon, and / or the 3' side of the second unit oligomer can comprise a nucleotide sequence complementary to a nucleotide sequence that resides in the vicinity of the 5 'end of an adjacent intron on the 3' side of the target exon.
[0059] The first and / or second unit oligomer may comprise a nucleotide sequence complementary to a partial nucleotide sequence of an exon RNA processing enhancer (ESE) of the target exon.
[0060] The target exon is not particularly limited. In one embodiment, the target exon is an exon in a human gene and is additionally an exon in the human dystrophin gene.
[0061] More specifically, the target exon is exon 44 in the human dystrophin gene.
[0062] Thus, in one embodiment, the present invention provides an antisense oligomer that causes exon 44 to jump in the human dystrophin gene (hereinafter referred to as "the oligomer of the present invention"). In the following, the structure of the antisense oligomer of the present invention will be described in detail. [Exon 44 in the human dystrophin gene]
[0063] In the present invention, the term "gene" must mean a genomic gene and also includes cDNA, precursor of mRNA and mRNA. Preferably, the gene is a precursor to mRNA, i.e., pre-mRNA.
[0064] In the human genome, the human dystrophin gene is located at the Xp21.2 site. The human dystrophin gene is 3.0 Mbp in size and is the largest gene among human genes known. However, the human dystrophin gene coding regions are only 14kb, distributed as 79 exons across the human dystrophin gene (Roberts, RG, et al., Genomics, 16: 536-538 (1993)). Pre-mRNA, which is the transcription of the human dystrophin gene, undergoes RNA processing to generate mature 14 kb mRNA. The wild-type dystrophin gene of the human nucleotide sequence is known (GenBank accession number NM_004006).
[0065] The nucleotide sequence of exon 44 in the human wild-type dystrophin gene is represented by SEQ ID NO: 10.
[0066] In one embodiment, the oligomer of the present invention is designed to cause the exon 44 to jump in the human dystrophin gene, thereby modifying the DMD type encoded protein of the dystrophin gene into the BMD type of the dystrophin protein. Thus, exon 44 in the dystrophin gene, which is the target of the exon jump by the antisense oligomer of the present invention, includes both wild and mutant types.
[0067] Specifically, exon 44 mutants of the human dystrophin gene include the polynucleotides defined in (I) or (II) below. (I) A polynucleotide that hybridizes under severe conditions to a polynucleotide that consists of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10; and, (II) A polynucleotide that consists of a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 10.
[0068] As used here, the expression "polynucleotide" must mean DNA or RNA.
[0069] As used herein, the term "polynucleotide that hybridizes under severe conditions" refers, for example, to a polynucleotide obtained by colony hybridization, plate hybridization, Southern hybridization or the like, using as a probe all or part of a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of, for example, SEQ ID NO: 10. The hybridization method that can be used includes methods described, for example, in “Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001, "" Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997, "etc.
[0070] As used herein, the term "complementary nucleotide sequence" is not limited only to nucleotide sequences that form Watson-Crick pairs with saved nucleotide sequences, but must include nucleotide sequences that form Wobble base pairs. As used herein, the term Watson-Crick pair refers to a pair of nucleobases in which hydrogen bonds are formed between adenine-thymine, adenine-uracil or aguanine-cytosine, and the term Wobbe base pair refers to a pair of nucleobases in which hydrogen bonds are formed between aguanine-uracil, inosine-uracil, inosine-adenine or inosine-cytosine. As used herein, the term "complementary nucleotide sequence" does not only refer to a nucleotide sequence 100% complementary to the target nucleotide sequence, but also refers to a complementary nucleotide sequence that may contain, for example, 1 to 3, 1 or 2, or a nucleotide not complementary to the target nucleotide sequence.
[0071] As used herein, the term "severe conditions" can be any of severe low conditions, moderate severe conditions or severe high conditions. The term "severe low conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 32 ° C. The term “moderate severe conditions” is, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 42 ° C, or 5x SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide at 42 ° C. The term “severe high conditions” is, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide at 50 ° C or 0.2 x SSC, 0.1% SDS at 65 ° C . Under these conditions, polynucleotides with higher homology are expected to be obtained efficiently at higher temperatures, although multiple factors are involved in the severity of hybridization, including temperature, probe concentration, probe length, ionic strength, time, salt concentration and others, and skilled in the art can appropriately select these factors to achieve similar severity.
[0072] When commercially available kits are used for hybridization, for example, an Alkphos Direct Labeling and Detection System (GE Healthcare) can be used. In this case, according to the attached protocol, after cultivation with a marked probe overnight, the membrane is washed with a primary wash buffer containing 0.1% (w / v) SDS at 55 ° C, thus detecting hybridized polynucleotides. Alternatively, in the production of a probe based on all or part of the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10, hybridization can be detected with a Nucleic Acid Detection Kit DIG (Roche Diagnostics) when the probe is marked with digoxigenin (DIG) using a commercially available reagent (for example, a PCR Labeling Mix (Roche Diagnostics), etc.).
[0073] In addition to the polynucleotides described above, other polynucleotides that can be hybridized include polynucleotides having 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more or 99.9% or more of identity with the polynucleotide of SEQ ID NO: 10, calculated by BLAST homology research software using the predefined parameters.
[0074] The identity between nucleotide sequences can be determined using the BLAST (Basic Local Alignment Search Tool) algorithm from Karlin and Altschul (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc. Natl. Acad. Sci. USA 90: 5873, 1993). Programs called BLASTN and BLASTX, based on the BLAST algorithm, have been developed (Altschul SF, et al: J. Mol. Biol. 215: 403, 1990). When a nucleotide sequence is sequenced using BLASTN, the parameters are, for example, punctuation = 100 and word size = 12. When BLAST and Gapped BLAST programs are used, the predefined parameters for each program are used.
[0075] The oligomer of the present invention is specifically an antisense oligomer having a length of 15 to 30 bases in which two unit oligomers selected from the group consisting of the following (a) and (b) are connected: (a) a unit oligomer that it consists of a nucleotide sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 1; and (b) a unitary oligomer consisting of a nucleotide sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 2.
[0076] For example, the first nucleotide sequence may be a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 1, and / or the second nucleotide sequence may be a nucleotide sequence 7 to 15 consecutive bases selected from the nucleotide sequence represented by SEQ ID NO: 2.
[0077] Preferably, the oligomer of the present invention is an antisense oligomer having a length of 15 to 30 bases to which two unit oligomers selected from the group consisting of the following (c) to (e) are connected: (c) a unit oligomer which consists of a sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 3; (d) a unitary oligomer consisting of a sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 4; and (e) a unitary oligomer consisting of a sequence complementary to a 7 to 15 consecutive base nucleotide sequence selected from the nucleotide sequence represented by SEQ ID NO: 5.
[0078] Here, the nucleotide sequences represented by SEQ ID NOs: 1 and 2 are the sequences consisting of the 1st to 44th bases and the 58th to 115th bases, respectively, of the 5 'end of the exon 44 nucleotide sequence ( SEQ ID NO: 10) in the human wild-type dystrophin gene.
The nucleotide sequence represented by SEQ ID NO: 3 is the sequence consisting of the 18th to 34th bases of the 5 'end of the exon 44 nucleotide sequence (SEQ ID NO: 10) in the human wild-type dystrophin gene. Similarly, the nucleotide sequences represented by SEQ ID NOs: 4 and 5 are the sequences consisting of the 61st to 77th bases and 88th to 104th bases, respectively.
[0080] The size of each of the unit oligomers (a) to (e) (hereinafter also simply referred to as "the units") is a length of 7 to 15 bases and is preferably a length of 8 to 15 bases, a 9 to 15 bases long, 10 to 15 bases long, 10 to 14 bases long, 10 to 13 bases long or 11 to 13 bases long. Units (a) to (e) can be the same size or different sizes.
[0081] To select two unit oligomers from the group consisting of (a) and (b), the two unit oligomers can be a combination of the same unit oligomers or they can be a combination of different unit oligomers. Specifically, the two unit oligomers can be a combination of (a) and (a) or a combination of (b) and (b) or they can be a combination of (a) and (b).
[0082] To select two unit oligomers from the group consisting of (c) to (e), the two unit oligomers can be a combination of the same unit oligomers or can be a combination of different unit oligomers. Preferably, the two units are respectively selected from different types. When, for example, (c) is selected as a unit, the other unit is preferably (d) or (e). Likewise, when (d) is selected as a unit, the other unit is preferably (c) or (e). Also, when (e) is selected as a unit, the other unit is preferably (c) or (d).
[0083] When units (a) and (b) are selected, either of the two selected units can be located on the 5 'side. When units (a) and (b) are selected, unit (a) is preferably connected on the 3 'side.
[0084] When two units are selected from (c) to (e), any of the two selected units can be located on the 5 'side. When units (c) and (d) are selected, unit (c) is preferably connected on the 3 'side. When units (d) and (e) are selected, unit (d) is preferably connected on the 3 'side. When units (c) and (e) are selected, unit (c) is preferably connected on the 3 'side.
[0085] As used here, the term "connect" refers to the direct connection of the two units selected from (a) and (b) or two units selected from (c) to (e). Specifically, the term "when two units are connected" means that the 3 'end of the unit positioned on the 5' side and the 5 'end of the unit positioned on the 3' side form a phosphate bond or group shown below. [Formula 3]
where X represents -OH, -CH2R1, -O-CH2R1, -S-CH2R1, -NR2R3 or F; R1 represents H or an alkyl; R2 and R3, which can be the same or different, each represents H, an alkyl, a cycloalkyl or an aryl; Y1 represents O, S, CH2 or NR1; Y2 represents O, S or NR1; Z represents O or S.
[0086] The expression "causes exon 44 to jump in the human dystrophin gene" should mean that, by binding the oligomer of the present invention to the site that corresponds to exon 44 of the transcription (eg, pre-mRNA) of the dystrophin gene of human, for example, thus resulting in the formation of mature mRNA, which is free of displacement of the codon frame, the nucleotide sequence corresponding to the 5 'end of exon 46 is cut and spliced into the nucleotide sequence corresponding to end 3 of exon 43 in DMD patients with deletion of exon 45 when transcription undergoes RNA processing.
[0087] Here, the term "binding" described above should mean that when the oligomer of the present invention is mixed with the transcription of the human dystrophin gene, both are hybridized under physiological conditions to form a double-stranded nucleic acid. The term "under physiological conditions" refers to the set of conditions that mimic the IN VIVO environment in terms of pH, salt composition and temperature. The conditions are, for example, 25 to 40 ° C, preferably 37 ° C, pH 5 to 8, preferably pH 7.4 and 150 mM sodium chloride concentration.
[0088] Whether or not the jump from exon 44 in the human dystrophin gene is provoked, this can be confirmed by introducing the oligomer of the present invention into a dystrophin expression cell (e.g., human rhabdomyosarcoma cells), amplifying the region which surrounds human dystrophin gene mRNA exon 44 of the total dystrophin expression cell by RT-PCR and performing pooled PCR or sequence analysis on the amplified PCR product.
[0089] The efficiency of the jump can be determined as follows. The mRNA for the human dystrophin gene is collected from the test cells; in mRNA, the level of polynucleotide "A" of the band where exon 44 is skipped and the level of polynucleotide "B" of the band where exon 44 is not skipped are measured. Using these measurement values from “A” and “B,” efficiency is calculated by the following equation: Jump efficiency (%) = A / (A + B) x 100
[0090] Alternatively, for the calculation of the jump efficiency, the international patent application WO2012 / 029986 can be referred.
[0091] Preferably, the antisense oligomer of the present invention causes the targeted exon to jump (for example, exon 44) with the efficiency of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.
[0092] The antisense oligomer of the present invention includes, for example, an oligonucleotide, morpholino oligomer or peptide nucleic acid (PNA) oligomer, having a length of 15 to 30 bases. The length is preferably from 16 to 30, from 17 to 30, from 18 to 30, from 19 to 30, from 20 to 30, from 20 to 29, from 20 to 28, from 20 to 27, from 20 to 26, from 21 to 26, or 22 to 26 bases and morpholino oligomers are preferred.
[0093] The oligonucleotide described above (hereinafter referred to as "the oligonucleotide of the present invention") is the oligomer of the present invention composed of nucleotides as constituent units. Such nucleotides can be any of modified ribonucleotides, deoxyribonucleotides and nucleotides.
The modified nucleotide refers to a having completely or partially modified nucleobases, sugar fractions and / or phosphate-binding region, which make up the ribonucleotide or deoxyribonucleotide.
[0095] The nucleobase includes, for example, adenine, aguanine, hypoxanthine, cytosine, thymine, uracil, and modified bases thereof. Examples of such modified bases include, but are not limited to, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosines (for example, 5-methylcytosine), 5-alkyluracils (for example, 5-ethyluracil), 5-halouracils (5 -bromouracil), 6-azapyrimidine, 6-alkylpyrimidines (6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, 5- (carboxy-hydroxymethyl) uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylamine , 1-methyladenine, 1-methyl-hypoxanthine, 2,2-dimethylaguanine, 3-methylcytosine, 2-methyladenine, 2-methylaguanine, N6-methyladenine, 7-methylaguanine, 5-methoxyminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5 - methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2,6-diaminopurine, 2-aminopurine, isoaguanine, indole, indole imidazole, xanthine, etc.
[0096] Modification of the sugar fraction may include, for example, modifications in the 2 'position of the ribose and modifications of the other sugar positions. The change in the 2 'position of the ribose includes replacement of the 2'-OH of the ribose by OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br or I, where R represents an alkyl or an aryl and R 'represents an alkylene.
[0097] The modification to the other sugar positions includes, for example, substitution of O at the 4 'position of the ribose or deoxyribose by S, linking between the 2' and 4 'positions of the sugar, for example, LNA (Blocked Nucleic Acid) ) or ENA (Nucleic Acids linked to 2'-O, 4'-C-Ethylene, but is not limited to these.
[0098] A modification of the phosphate binding region includes, for example, a substitution modification of the phosphodiester bond by phosphorothioate bond, phosphorodithioate bond, alkyl phosphonate bond, phosphoramidate bond or boranophosphate bond (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (cf., for example, new Japanese domestic patent applications from PCT patent applications Nos. 2006/129594 and 2006/038608).
[0099] The alkyl is preferably straight or branched alkyl having 1 to 6 carbon atoms. Specific examples include methyl, ethyl, N-propyl, isopropyl, N-butyl, isobutyl, SEC-butyl, TERC-butyl, N-pentyl, isopentyl, neopentyl, TERC-pentyl, N-hexyl and isohexyl. The alkyl can optionally be replaced. Examples of such substituents are a halogen, an alkoxy, cyano and nitro. The alkyl can be substituted by one to three of such substituents.
[00100] Cycloalkyl is preferably a cycloalkyl having 5 to 12 carbon atoms. Specific examples include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl and cyclododecyl.
[00101] Halogen includes fluorine, chlorine, bromine and iodine.
[00102] The alkoxy is a straight or branched alkoxy having 1 to 6 carbon atoms, such as methoxy, ethoxy, N-propoxy, isopropoxy, N-butoxy, isobutoxy, SEC-butoxy, TERC-butoxy, N-pentyloxy, isopentyloxy , N-hexyloxy, that-hexyloxy, etc. Among others, an alkoxy having 1 to 3 carbon atoms is preferred.
[00103] Aryl is preferably an aryl having 6 to 10 carbon atoms. Specific examples include phenyl, α-naphthyl and β-naphthyl. Among others, phenyl is preferred. The aryl can optionally be replaced. Examples of such substituents are an alkyl, a halogen, an alkoxy, cyano and nitro. The aryl can be substituted by one to three such substituents.
[00104] In this invention, alkylene is preferably a straight or branched alkylene having 1 to 6 carbon atoms. Specific examples include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2- (ethyl) trimethylene and 1- (methyl) tetramethylene.
[00105] Acyl includes a straight or branched alkanoyl or aroyl. Examples of the alkanoyl include formyl, acetyl, 2-methylacetyl, 2,2-dimethylacetyl, propionyl, butyryl, isobutyryl, pentanoyl, 2,2-dimethylpropionyl, hexanoyl, etc. Examples of aroila include benzoyl, toluoyl and naphthyl. The aroila can optionally be replaced in replaceable positions and can be replaced by an alkyl (s).
[00106] Preferably, the oligonucleotide of the present invention is the oligomer of the present invention containing a constituent unit represented by the general formula below in which the -OH group at the 2 'position of the ribose is replaced by methoxy and the phosphate-binding region is a phosphorothioate bond: [Formula 4]
where the base represents a nucleobase.
[00107] The oligonucleotide of the present invention can be easily synthesized using several automated synthesizers (for example, AKTA oligopilot plus 10/100 (GE Healthcare)). Alternatively, the synthesis can also be entrusted to a third party organization (for example, Promega Inc. or Takara Co.), etc.
[00108] The morpholino oligomer described above is the oligomer of the present invention comprising the constituent unit represented by the following general formula: [Formula 5]
where Base has the same significance as previously defined, and, W represents a group shown by any of the following groups: [Formula 6]
where X represents -CH2R1, -O-CH2R1, -S-CH2R1, -NR2R3 or F; R1 represents H or an alkyl; R2 and R3, which can be the same or different, each represents H, an alkyl, a cycloalkyl or an aryl; Y1 represents O, S, CH2 or NR1; Y2 represents O, S or NR1; Z represents O or S.
[00109] Preferably, the morpholino oligomer is an oligomer comprising a constituent unit represented by the following general formula (morpholino phosphorodiamidate oligomer (hereinafter referred to as "PMO")). [Formula 7]
where Base, R2 and R3 have the same significance as previously defined.
[00110] The morpholino oligomer can be produced according to, for example, WO 1991/009033 or WO 2009/064471. In particular, PMO can be produced by the procedure described in WO 2009/064471 or WO2013 / 100190. Method for producing PMO]
[00111] A PMO modality is, for example, the compound represented by the general formula (I) below (hereinafter PMO (I)). [Formula 8]
where Base, R2 and R3 have the same significance as previously defined; and, n is a given integer from 1 to 99, preferably a given integer from 18 to 28.
[00112] PMO (I) can be produced according to a known method, for example, it can be produced by performing the procedures in the following steps.
[00113] The compounds and reagents used in the following steps are not particularly limited, as long as they are commonly used to prepare PMO.
[00114] Also, the following steps can all be performed by the liquid phase method or the solid phase method (using automated or commercially available automated solid phase synthesizers). In the production of PMO by the solid phase method, it is desired to use automated synthesizers in view of the simple operating procedures and exact synthesis. (1) Step A:
[00115] The compound represented by the general formula (II) below (hereinafter referred to as compound (II)) reacts with an acid to prepare the compound represented by the general formula (III) below (hereinafter referred to as Compound (III) ): [Formula 9]
independently represents a nucleobase that can optionally be protected; T represents trityl, monomethoxytrityl or dimethoxytrityl; and, L represents hydrogen, an acyl or a group represented by the general formula (IV) below (hereinafter referred to as group (IV)). [Formula 10]
The "nucleobase" for BP includes the same "nucleobase" as in Base, as long as the amino or hydroxy group in the nucleobase shown by BP can be protected.
[00116] Such an amino protecting group is not particularly limited, as long as it is used as a protecting group for nucleic acids. Specific examples include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl and (dimethylamino) methylene. Specific examples of the protecting group for the hydroxy group include 2-cyanoethyl, 4-nitrophenethyl, phenylsulfonylethyl, methylsulfonylethyl and trimethylsilylethyl, and phenyl, which can be substituted by 1 to 5 electron-withdrawing groups in optional replaceable positions, diphenylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, diethylcarbamoyl, diethylcarbamoyl, methylphenylcarbamoyl, 1-pyrolidinylcarbamoyl, morpholinocarbamoyl, 4- (tert-butylcarboxy) benzyl, 4 - [(dimethylamino) carboxy] benzyl and 4- (phenylcarboxy) benzyl, (cf., for example, WO 2009/064471).
[00117] The "solid carrier" is not particularly limited, as long as it is a useful carrier for the solid phase reaction of nucleic acids. It is desired that the solid carrier has the following properties: for example, (i) it is slightly soluble in reagents that can be used for the synthesis of nucleic acid derivatives (for example, dichloromethane, acetonitrile, tetrazole, N-methylimidazole, pyridine, acetic anhydride, lutidine, trifluoroacetic acid); (ii) it is chemically stable to reagents useful for the synthesis of nucleic acid derivatives; (iii) it can be chemically modified; (iv) it can be loaded with desired nucleic acid derivatives; (v) it has sufficient strength to remove high pressure through treatments; and (vi) it has a uniform particle diameter range and distribution. Specifically, swelling polystyrene (eg, aminomethyl polystyrene resin 1% dibenzylbenzene crosslinked (200-400 mesh) (2.4 to 3.0 mmol / g) (manufactured by Tokyo Chemical Industry), Aminomethylated Polystyrene Resin ^ HCl [dibenzylbenzene 1%, 100-200 mesh] (manufactured by Peptide Institute, Inc.)), non-swelling polystyrene (eg Primer Support (manufactured by GE Healthcare)), polystyrene attached to the PEG chain (eg NH2-PEG resin (manufactured by Watanabe Chemical Co.), TentaGel resin), controlled pore glass (controlled pore glass; CPG) (manufactured by, for example, CPG), oxalyl controlled pore glass (cf., for example, Alul et al., Nucleic Acids Research, Vol. 19, 1527 (1991)), derivatized aminopolyethylene glycol support-TentaGel support (eg, Wright et al., cf., Tetrahedron Letters, Vol. 34, 3373 (1993)), and a pore-polystyrene / divinylbenzene copolymer.
[00118] A "linker" that can be used is a known linker generally used to connect nucleic acids or derivatives of nucleic acid. Examples include 3-aminopropyl, succinyl, 2,2'-diethanololsulfonyl and a long chain amino alkyl (LCAA).
[00119] This step can be performed by reacting compound (II) with an acid.
[00120] The "acid" that can be used in this step includes, for example, trifluoroacetic acid, dichloroacetic acid and trichloroacetic acid. The acid used is suitably in a range of, for example, 0.1 mol equivalent to 1,000 mol equivalent, based on 1 mol of compound (II), preferably in a range of 1 mol equivalent to 100 mol equivalent, based on 1 mol of compound (II).
[00121] An organic amine can be used in combination with the acid described above. The organic amine is not particularly limited and includes, for example, triethylamine. The amount of the organic amine used is suitably in a range of, for example, 0.01 mol equivalent to 10 mol equivalent, and preferably in a range of 0.1 mol equivalent to 2 mol equivalent, based on 1 mol of the acid.
[00122] When a salt or mixture of acid and organic amine is used in this step, the salt or mixture includes, for example, a salt or mixture of trifluoroacetic acid and triethylamine, and more specifically, a mixture of 1 equivalent of triethylamine and 2 equivalents of trifluoroacetic acid.
[00123] The acid that can be used in this step can also be used in the form of a dilution with an appropriate solvent in a concentration of 0.1% to 30%. The solvent is not particularly limited, as it is inert to the reaction and includes, for example, dichloromethane, acetonitrile, an alcohol (ethanol, isopropanol, trifluoroethanol, etc.), water or a mixture thereof.
[00124] The reaction temperature in the reaction described above is preferably in a range, for example, 10 ° C to 50 ° C, more preferably, in a range of 20 ° C to 40 ° C, and more preferably, in a range 25 ° C to 35 ° C.
[00125] The reaction time may vary depending on the type of acid used and the reaction temperature and is suitably in a range of 0.1 minute to 24 hours, in general, and preferably in a range of 1 minute to 5 hours.
[00126] After completing this step, a base can be added, if necessary, to neutralize the acid that remained in the system. The "base" is not particularly limited and includes, for example, diisopropylamine. The base can also be used in the form of a dilution with an appropriate solvent in a concentration of 0.1% (v / v) to 30% (v / v).
[00127] The solvent used in this step is not particularly limited, as long as it is inert to the reaction and includes dichloromethane, acetonitrile, an alcohol (ethanol, isopropanol, trifluoroethanol, etc.), water and a mixture thereof. The reaction temperature is preferably in a range, for example, 10 ° C to 50 ° C, more preferably, in a range of 20 ° C to 40 ° C, and more preferably, in a range of 25 ° C to 35 ° C.
[00128] The reaction time may vary depending on the type of the base used and the reaction temperature and is suitably in a range of 0.1 minute to 24 hours, in general, and preferably in a range of 1 minute to 5 hours.
[00129] In compound (II), the compound of the general formula (IIa) below (hereinafter Compound (IIa)), where n is 1 and L is a group (IV), can be produced by the following procedure. [Formula 11]
where BP, T, ligand and solid carrier have the same significance as previously defined.
[00130] Step 1:
[00131] The compound represented by the general formula (V) below is reacted with an acylating agent to prepare the compound represented by the general formula (VI) below (hereinafter referred to as Compound (VI)). [Formula 12]
where BP, T and ligand have the same significance as previously defined; and, R4 represents hydroxy, a halogen, carboxyl or amino group.
[00132] This step can be performed by known procedures by introducing binders, using Compound (V) as the starting material.
[00133] In particular, the compound represented by the general formula (VIa) below can be produced by performing the method known as esterification, using Compound (V) and succinic anhydride. [Formula 13]
where BP and T have the same significance as previously defined. Step 2:
[00134] Compound (VI) was reacted with a solid carrier by a condensing agent to prepare the compound (IIa). [Formula 14]
where BP, R4, T, ligand and solid carrier have the same significance as previously defined.
[00135] This step can be performed using Compound (VI) and a solid carrier according to a process known as the condensation reaction.
[00136] In compound (II), the compound represented by the general formula (IIa2) below where n is 2 to 99 and L is a group represented by the general formula (IV) can be produced using Compound (IIa) as the material starting and repeating step A and step B of the PMO production method described in the patent application for a desired number of times. [Formula 15]
where BP, R, R, T, ligand and solid carrier have the same significance as previously defined; and, n 'represents 1 to 98.
[00137] In compound (II), the compound of the general formula (IIb) below where n is 1 and L is hydrogen can be produced by the procedure described in, for example, WO 1991/009033. [Formula 16]
where BP, n ', R2, R3 and T have the same significance as previously defined.
[00138] In compound (II), the compound represented by the general formula (IIb2) below where n is 2 to 99 and L is hydrogen can be produced using Compound (IIb) as the starting material and repeating step A and step B of the PMO production method described in the patent application for a desired number of times. [Formula 17]
where BP, n ', R2, R3 and T have the same significance as previously defined.
[00139] In compound (II), the compound represented by the general formula (IIc) below where n is 1 and L is an acyl can be produced by performing the procedure known as an acylation reaction, using compound (IIb). [Formula 18]
where BP and T have the same significance as previously defined; and, R5 represents an acyl.
[00140] In compound (II), the compound represented by the general formula (IIc2) below where n is 2 to 99 and L is an acyl can be produced using Compound (IIc) as the starting material and repeating step A and step B of the PMO production method described in the patent application for a desired number of times. [Formula 19]
where BP, n ', R2, R3, R5 and T have the same significance as previously defined. (2) Step B
[00141] Compound (III) reacted with a morpholino monomer compound in the presence of a base to prepare the compound represented by the following general formula (VII) (hereinafter referred to as Compound (VII)): [Formula 20]
where BP, L, n, R2, R3 and T have the same significance as previously defined.
[00142] This step can be performed by reacting compound (III) with a morpholino monomer compound in the presence of a base.
[00143] The morpholino monomer compound includes, for example, compounds represented by the following general formula (VIII): [Formula 21]
where BP, R2, R3 and T have the same significance as previously defined.
[00144] The "base" that can be used in this step includes, for example, diisopropylamine, triethylamine and N-ethylmorpholine. The amount of the base used is suitably in a range of 1 mol equivalent to 1,000 mol equivalent, based on 1 mol equivalent (III), preferably 10 mol equivalent to 100 mol equivalent, based on 1 mol equivalent (III) .
[00145] The morpholino monomer compound and base that can be used in this step can also be used as a dilution with an appropriate solvent in a concentration of 0.1% to 30%. The solvent is not particularly limited, as long as it is inert to the reaction, and includes, for example, N, N-dimethylimidazolidone, N-methylpiperidone, DMF, dichloromethane, acetonitrile, tetrahydrofuran, or a mixture thereof.
[00146] The reaction temperature is preferably in the range of, for example, 0 ° C to 100 ° C, and more preferably, in the range of 10 ° C to 50 ° C.
[00147] The reaction time may vary depending on the type of the base used and the reaction temperature and is suitably in a range of 1 minute to 48 hours, in general, and preferably in a range of 30 minutes to 24 hours.
[00148] Furthermore, after completing this step, an acylating agent can be added, if necessary. The "acylating agent" includes, for example, acetic anhydride, acetyl chloride and phenoxyacetic anhydride. The acylating agent can also be used as a dilution with an appropriate solvent in a concentration of 0.1% to 30%. The solvent is not particularly limited, as long as it is inert to the reaction, and includes, for example, dichloromethane, acetonitrile, an alcohol (s) (ethanol, isopropanol, trifluoroethanol, etc.), water, or a mixture thereof.
[00149] If necessary, a base, such as pyridine, lutidine, choline, triethylamine, diisopropylethylamine, N-ethylmorpholine, etc. it can also be used in combination with the acylating agent. The amount of the acylating agent is suitably in a range of 0.1 mol equivalent to 10,000 mol equivalent, and preferably in a range of 1 mol equivalent to 1,000 mol equivalent. The amount of the base is suitably in a range, for example, 0.1 mol equivalent to 100 mol equivalent, and preferably in a range of 1 mol equivalent to 10 mol equivalent, based on 1 mol of the acylating agent.
[00150] The reaction temperature in this reaction is preferably in a range of 10 ° C to 50 ° C, more preferably, in a range of 10 ° C to 50 ° C, much more preferably, in a range of 20 ° C to 40 ° C, and more preferably, in a range of 25 ° C to 35 ° C. The reaction time may vary depending on the type of acylating agent used and the reaction temperature, and is suitably in a range of 0.1 minute to 24 hours, in general, and preferably in a range of 1 minute to 5 hours. (3) Step C:
[00151] In the compound (VII) produced in step B, the protecting group is removed using a deprotecting agent to prepare the compound represented by the general formula (IX). [Formula 22]
where Base, BP, L, n, R2, R3 and T have the same significance as previously defined.
[00152] This step can be carried out by reacting the compound (VII) with a deprotecting agent.
[00153] The "deprotecting agent" includes, for example, concentrated ammonia, water and methylamine. The "deprotecting agent" used in this step can also be used as a dilution with, for example, water, methanol, ethanol, isopropyl alcohol, acetonitrile, tetrahydrofuran, DMF, N, N-dimethylimidazolidone, N-methylpiperidone, or a mixture of these solvents. Among these, ethanol is preferred. The amount of the deprotecting agent used is suitably within a range of, 1 mol equivalent to 100,000 mol equivalent, and preferably in a range of 10 mol equivalent to 1,000 mol equivalent, based on 1 mol of compound (VII).
[00154] The reaction temperature is suitably in a range of 15 ° C to 75 ° C, preferably in a range of 40 ° C to 70 ° C, and more preferably, in a range of 50 ° C to 60 ° C . The reaction time for deprotection can vary depending on the type of compound (VII), reaction temperature, etc., and is suitably in a range of 10 minutes to 30 hours, preferably 30 minutes to 24 hours, and more preferably in a range from 5 hours to 20 hours. (4) Step D:
[00155] PMO (I) is produced by reacting the compound (IX) produced in step C with an acid: [Formula 23]
where Base, n, R2, R3 and T have the same significance as previously defined.
[00156] This step can be performed by adding an acid to the compound (IX).
[00157] The "acid" that can be used in this step includes, for example, trichloroacetic acid, dichloroacetic acid, acetic acid, phosphoric acid, hydrochloric acid, etc. The acid used is appropriately used to allow the solution to have a pH range of 0.1 to 4.0, and more preferably, a pH range of 1.0 to 3.0. The solvent is not particularly limited, as long as it is inert to the reaction, and includes, for example, acetonitrile, water, or a mixture of these solvents thereof.
[00158] The reaction temperature is suitably in a range of 10 ° C to 50 ° C, preferably in a range of 20 ° C to 40 ° C, and more preferably, in a range of 25 ° C to 35 ° C . The reaction time for deprotection can vary depending on the type of compound (IX), reaction temperature, etc., and is suitably in a range of 0.1 minute to 5 hours, preferably 1 minute to 1 hour, and more preferably in a range from 1 minute to 30 minutes.
[00159] PMO (I) can be obtained by subjecting the reaction mixture obtained in this step to conventional means of separation and purification operation, such as extraction, concentration, neutralization, filtration, centrifugal separation, recrystallization, reverse phase column chromatography C8 to C18, cation exchange column chromatography, anion exchange column chromatography, gel filtration column chromatography, high performance liquid chromatography, dialysis, ultrafiltration, etc., alone or in combination. Thus, the desired PMO (I) can be isolated and purified (cf., for example, WO 1991/09033).
[00160] In PMO (I) purification using reverse phase chromatography, for example, a mixture of 20 mM triethylamine solution / acetate and acetonitrile buffer can be used as an elution solvent.
[00161] In the purification of PMO (I) using ion exchange chromatography, for example, a mixture of 1 M saline solution and 10 mM aqueous sodium hydroxide solution can be used as an elution solvent.
[00162] The peptide nucleic acid described above is the oligomer of the present invention having a group represented by the following general formula as the constituent unit: [Formula 24]
where Base has the same significance as previously defined.
[00163] Peptide nucleic acids can be prepared by referring, for example, to the following literature. 1) PE Nielsen, M. Egholm, RH Berg, O. Buchardt, Science, 254, 1497 (1991) 2) M. Egholm, O. Buchardt, PE Nielsen, RH Berg, Jacs., 114, 1895 (1992) 3 ) KL Dueholm, M. Egholm, C. Behrens, L. Christensen, HF Hansen, T. Vulpius, KH Petersen, RH Berg, PE Nielsen, O. Buchardt, J. Org. Chem., 59, 5767 (1994) 4 ) L. Christensen, R. Fitzpatrick, B. Gildea, KH Petersen, HF Hansen, T. Koch, M. Egholm, O. Buchardt, PE Nielsen, J. Coull, RH Berg, J. Pept. Sci., 1, 175 (1995) 5) T. Koch, H. F. Hansen, P. Andersen, T. Larsen, H. G. Batz, K. Otteson, H. Orum, J. Pept. Res., 49, 80 (1997)
[00164] In the oligomer of the present invention, the 5 'end can be any of the chemical structures (1) to (3) below, and is preferably (3) - OH. [Formula 25]

[00165] In the following, the groups shown by (1), (2) and (3) previously are referred to as "Group (1)," "Group (2)" and "Group (3)," respectively. 2. Pharmaceutical composition
[00166] The oligomer of the present invention causes the exon 44 to jump in the dystrophin gene. Thus, it is expected that conditions of muscular dystrophy can be alleviated by administering the pharmaceutical composition comprising the oligomer of the present invention to patients with DMD, who have a mutation target of the exon 44 jump, which is a mutation that converts them into the framework by the exon jump. 44. Also, the process of making the oligomer of the present invention, whose chain length is short, is simple and the cost of making the oligomer of the present invention can be reduced.
[00167] In another embodiment, the present invention provides the pharmaceutical composition for the treatment of muscular dystrophy, comprising, as an active ingredient, the oligomer of the present invention, a pharmaceutically acceptable salt or hydrate thereof (hereinafter referred to as “the composition of the present invention ”)
[00168] Examples of the pharmaceutically acceptable oligomer salt of the present invention contained in the composition of the present invention are alkali metal salts, such as sodium, potassium and lithium salts; alkaline earth metal salts, such as calcium and magnesium salts; metal salts, such as aluminum, iron, zinc, copper, nickel, cobalt salts, etc .; ammonium salts; organic amine salts, such as t-octylamine, dibenzylamine, morpholine, glucosamine, phenylglycine alkyl ester, ethylenediamine, N-methylglucamine, guanidine, diethylamine, triethylamine, dicyclohexylamine, N, N '- dibenzylethylenedine, procylamine, chloramine diethanolamine, N-benzylphenethylamine, piperazine, tetramethylammonium, tris (hydroxymethyl) aminomethane; hydrohalide salts, such as hydrochloride, hydrochloride, hydrobromide and ihydrate salts; inorganic acid salts, such as nitrates, perchlorates, sulfates, phosphates, etc .; lower alkane sulfonates, such as methanesulfonates, trifluoromethanesulfonates and ethanesulfonates; arylsulfonates, such as benzenesulfonates and p-toluenesulfonates; organic acid salts, such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, maleates, etc .; and, amino acid salts, such as glycine, lysine, arginine, ornithine, glutamic acid and aspartic acid salts. These salts can be produced by known methods. Alternatively, the oligomer of the present invention contained in the composition of the present invention can be in the form of a hydrate thereof.
[00169] The route of administration for the composition of the present invention is not particularly limited, as long as it is a pharmaceutically acceptable route of administration, and can be chosen depending on the method of treatment. In view of the ease in dispensing to muscle tissues, preferred are intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, oral administration, administration to tissue, transdermal administration, etc. Also, dosage forms that are available for the composition of the present invention are not particularly limited and include, for example, various injections, oral agents, drips, inhalations, ointments, lotions, etc.
[00170] In administering the oligomer of the present invention to patients with muscular dystrophy, the composition of the present invention preferably contains a carrier to promote dispensing the oligomer to the muscle tissues. Such a carrier is not particularly limited in that it is pharmaceutically acceptable and examples include cationic carriers, such as cationic liposomes, cationic polymers, etc., or carriers using a viral envelope. Cationic liposomes are, for example, liposomes composed of 2-O- (2-diethylaminoethyl) carabamoyl-1,3-O-dioleoylglycerol and phospholipids as the essential constituents (hereinafter referred to as “liposome A”), Oligofectamine (trade name registered) (manufactured by Invitrogen Corp.), Lipofectin (registered trade name) (manufactured by Invitrogen Corp.), Lipofectamine (registered trade name) (manufactured by Invitrogen Corp.), Lipofectamine 2000 (registered trade name) (manufactured by Invitrogen Corp .), DMRIE-C (registered trade name) (manufactured by Invitrogen Corp.), GeneSilencer (registered trade name) (manufactured by Gene Therapy Sistemas), TransMessenger (registered trade name) (manufactured by QIAGEN, Inc.), TransIT TKO (registered trade name) (manufactured by Mirus) and Nucleofector II (Lonza). Among others, liposome A is preferred. Examples of cationic polymers are JetSI (registered trade name) (manufactured by Qbiogeno, Inc.) and Jet-PEI (registered trade name) (polyethyleneimine, manufactured by Qbiogeno, Inc.). An example of carriers using a viral envelope is GenomeOne (registered trade name) (HVJ-E liposome, manufactured by Ishihara Sangyo). Alternatively, the medical devices described in Japanese patent No. 2924179 and the cationic carriers described in the new Japanese domestic patent applications PCT Nos. 2006/129594 and 2008/096690 can also be used.
[00171] A concentration of the oligomer of the present invention contained in the composition of the present invention can vary depending on the type of carrier, etc., and is suitably in a range of 0.1 nM to 100 μM, preferably in a range of 1 nM to 10 μM, and more preferably in a range of 10 nM to 1 μM. A weight ratio of the oligomer of the present invention contained in the composition of the present invention and the carrier (carrier / oligomer of the present invention) can vary depending on the property of the oligomer, the type of the carrier, etc., and is suitably in a range of 0 , 1 to 100, preferably in a range of 1 to 50, and more preferably in a range of 10 to 20.
[00172] In addition to the oligomer of the present invention and the carrier described above, pharmaceutically acceptable additives can also be optionally formulated in the composition of the present invention. Examples of such additives are emulsifying aids (for example, fatty acids having 6 to 22 carbon atoms and their pharmaceutically acceptable salts, albumin and dextran), stabilizers (for example, cholesterol and phosphatidic acid), isotonizing agents (for example, chloride sodium, glucose, maltose, lactose, sucrose, trehalose), and pH-controlling agents (for example, hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide and triethanolamine). One or more of these additives can be used. The content of the additive in the composition of the present invention is suitably 90% by weight or less, preferably 70% by weight or less and more preferably, 50% by weight or less.
[00173] The composition of the present invention can be prepared by adding the oligomer of the present invention to a dispersion of the carrier and suitably stirring the mixture. Additives can be added at an appropriate stage both before and after the addition of the oligomer of the present invention. An aqueous solvent that can be used in the addition of the oligomer of the present invention is not particularly limited, as long as it is pharmaceutically acceptable, and examples are injectable water or injectable distilled water, electrolyte fluid, such as physiological saline, etc., and fluid sugar, such as glucose fluid, maltose fluid, etc. One skilled in the art can appropriately choose conditions for pH and temperature for such a subject.
[00174] The composition of the present invention can be prepared, for example, in a liquid form and its lyophilized preparation. The lyophilized preparation can be prepared by lyophilizing the composition of the present invention in a liquid form in a conventional manner. Lyophilization can be carried out, for example, appropriately sterilizing the composition of the present invention in a liquid form, dispensing an aliquot in a vial container, performing preliminary freezing for 2 hours in conditions of about -40 to -20 ° C, performing a primary drying at about 0 to 10 ° C under reduced pressure, and then performing a secondary drying at about 15 to 25 ° C under reduced pressure. In general, the lyophilized preparation of the composition of the present invention can be obtained by replacing the contents of the flask with nitrogen gas and capping.
[00175] The lyophilized preparation of the composition of the present invention can be used, in general, by reconstitution by adding an optional suitable solution (reconstitution liquid) and redissolving the preparation. A reconstitution liquid like this includes injectable water, physiological saline and other infusion fluids. A volume of the reconstitution liquid can vary depending on the intended use, etc., is not particularly limited and is suitably 0.5 to 2 times greater than the volume before lyophilization or no more than 500 ml.
[00176] It is desired to control a dose of the composition of the present invention to be administered, taking the following factors into consideration: the type and dosage form of the oligomer contained in the present invention; patient conditions including age, body weight, etc .; route of administration; and the characteristics of the extent of the disease. A daily dose, calculated as the amount of the antisense oligomer of the present invention, is generally in the range of 0.1 mg to 10 g / human, and preferably 1 mg to 1 g / human. This numerical range may vary from time to time depending on the type and target disease, route of administration and target molecule. Thus, a dose lower than the band may be sufficient at some time and, on the contrary, a dose greater than the band may occasionally be required. The composition can be administered one to several times a day or at intervals of one day to several days.
[00177] In yet another embodiment of the composition of the present invention, a pharmaceutical composition is provided comprising a vector capable of expressing the oligonucleotide of the present invention and the carrier described above. An expression vector like this can be a vector capable of expressing a plurality of the oligonucleotides of the present invention. The composition can be formulated with pharmaceutically acceptable additives, as in the case with the composition of the present invention containing the oligomer of the present invention. A concentration of the expression vector contained in the composition can vary depending on the type of carrier, etc., and is suitably in a range of 0.1 nM to 100 μM, preferably in a range of 1 nM to 10 μM, and more preferably in a range of 10 nM to 1 μM. A weight ratio of the expression vector contained in the composition and the carrier (carrier / expression vector) can vary depending on the property of the expression vector, carrier type, etc., and is appropriately in a range of 0.1 to 100 , preferably in a range of 1 to 50, and more preferably in a range of 10 to 20. The content of the carrier contained in the composition is the same as in the case with the composition of the present invention containing the oligomer of the present invention, and a method to produce the same is also the same as in the case with the composition of the present invention.
[00178] In the following, the present invention will be described in more detail with reference to the EXAMPLES and TEST EXAMPLES below, but is not considered to be limited thereto. [EXAMPLES] [REFERENCE EXAMPLE 1] 4 - {[(2S, 6R) -6- (4-benzamido-2-oxopyrimidin-1-yl) -4-tritylmorpholin-2-yl1-methoxy} -4-oxobutanoic acid in amino polystyrene resin Step 1: Production of 4 - {[(2S, 6R) -6- (4-benzamido-2-oxopyrimidin- 1 (2H) -yl) - 4-tritylmorfolin-2-yl1methoxy} -4 -oxobutanoic
[00179] In an argon atmosphere, 3.44 g of N- {1 - [(2R, 6S) -6- (hydroxymethyl) - 4-tritylmorpholin-2-yl1-2-oxo-1,2-dihydropyrimidin -4- yl} benzamide and 1.1 g of 4-dimethylaminopyridine (4-DMAP) were suspended in 50 ml of dichloromethane, and 0.90 g of succinic anhydride was added to the suspension, followed by stirring at room temperature for 3 hours . To the reaction mixture, 10 ml of methanol was added, and the mixture was concentrated under reduced pressure. The residue was extracted using ethyl acetate and 0.5 M aqueous potassium dihydrogen phosphate solution. The resulting organic layer was washed sequentially with 0.5 M aqueous potassium dihydrogen phosphate solution, water and brine in the order mentioned. The resulting organic layer was dried over sodium sulfate and concentrated under reduced pressure to give 4.0 g of the product. Step 2; Production of 4 - {[(2S, 6R) -6- (4-benzamido-2-oxopyrimidin-1-yl) -4-tritylmorpholin-2-yl1methoxy} -4-oxobutanoic acid loaded on polystyrene amino resin
[00180] After 4.0 g of 4 - {[(2S, 6R) -6- (4-benzamido-2-oxopyrimidin-1 (2H) -yl) -4-tritylmorpholin-2-yl] methoxy acid} -4-oxobutanoic were dissolved in 200 ml of pyridine (dehydrated), 0.73 g of 4-DMAP and 11.5 g of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride were added to the solution. Then, 25.0 g of polystyrene amino resin primer 200 amino (manufactured by GE Healthcare Japan Co., Ltd., 17-5214-97) and 8.5 ml of triethylamine were added to the mixture, followed by stirring the room temperature for 4 days. After finishing the reaction, the resin was removed by filtration. The resulting resin was washed sequentially with pyridine, methanol and dichloromethane in the order mentioned, and dried under reduced pressure. To the resulting resin, 200 ml of tetrahydrofuran (dehydrated), 15 ml of acetic anhydride and 15 ml of 2,6-lutidine were added, and the mixture was stirred at room temperature for 2 hours. The resin was removed by filtration, washed sequentially with pyridine, methanol and dichloromethane in the order mentioned and dried under reduced pressure to give 26.7 g of the product.
[00181] The amount of product charge was determined from the molar amount of trityl per g of resin by measuring UV absorbance at 409 nm using a known method. The amount of resin loading was 192.2 μmol / g. UV measurement conditions Device: U-2910 (Hitachi, Ltd.) Solvent: methanesulfonic acid Wavelength: 265 nm ε value: 45,000 [REFERENCE EXAMPLE 2] Acid 4 - {[(2S, 6R) -6- ( 5-methyl-2,4-dioxopyrimidine-1-yl) -4-tritylmorpholin-2-yl] methoxy} -4-oxobutanoic loaded on polystyrene amino resin
[00182] The title compound was produced in a similar manner to REFERENCE EXAMPLE 1, except that 1 - [(2R, 6S) -6- (hydroxymethyl) -4-tritylmorpholin-2-yl] -5-methylpyrimidine-2, 4 (1H, 3H) -dione was used in this step, instead of N- {1 - [(2R, 6S) -6- (hydroxymethyl) -4-tritylmorpholin-2-yl] -2-oxo-1,2 -di- hydropyrimidin-4-yl} benzamide used in step 1 of REFERENCE EXAMPLE 1.
[00183] The charge amount of the product was determined from the molar amount of trityl per g of resin by measuring UV absorbance at 409 nm using a known method. The amount of resin loading was 164.0 μmol / g. [REFERENCE EXAMPLE 3] 4 - {[(2S, 6R) -6- (6-benzamido purine-9-yl) -4-tritylmorpholin-2-yl] methoxy} -4-oxobutanoic acid loaded on polystyrene amino resin
[00184] The title compound was produced in a similar manner to REFERENCE EXAMPLE 1, except that N- {9 - [(2R, 6S) -6- (hydroxymethyl) -4-tritylmorpholin-2-yl] purine-6- il} benzamido was used in this step, instead of N- {1 - [(2R, 6S) -6- (hydroxymethyl) -4-tritylmorpholin-2-yl] -2-oxo- 1,2-dihydropyrimidin- 4-yl} benzamide used in step 1 of REFERENCE EXAMPLE 1.
[00185] The charge amount of the product was determined from the molar amount of the trityl per g of resin by measuring UV absorbance at 409 nm using a known method. The amount of resin loading was 185.7 μmol / g. [REFERENCE EXAMPLE 4] Acid 4 - {{(2S, 6R) -6- {6-2-cyanoethoxy} -2 - [(2-phenoxyacetyl) amino] purine-9-yl} -4-tritylmorfolin-2- il} metóxi} -4-oxobutanoico loaded in amino polystyrene resin
[00186] The title compound was produced in a similar manner to REFERENCE EXAMPLE 1, except that N- {6- (2-cyanoethoxy) -9- [(2R, 6S) -6- (hydroxymethyl) -4-tritilmorfolin- 2-yl] purine-2-yl} -2-phenoxyacetoamido was used in this step, instead of N- {1 - [(2R, 6S) -6- (hydroxymethyl) -4-tritylmorpholin-2-yl] -2 -oxo-1,2-dihydropyrimidin-4-yl} benzamide used in step 1 of REFERENCE EXAMPLE 1.
[00187] The amount of product charge was determined from the molar amount of trityl per g of resin by measuring UV absorbance at 409 nm using a known method. The amount of resin loading was 164.8 μmol / g.
[00188] According to the descriptions in EXAMPLES 1 below, PMO shown by PMO Nos. 1-118 in TABLE 1 have been synthesized. PMO Nos. 119 and 120 were purchased from Gene Tools, LLC. The synthesized PMO was dissolved in water for injection (manufactured by Otsuka Pharmaceutical Factory, Inc.). [Table 1-1] [TABLE 1]


[EXAMPLE 1]
[00189] As a base at the 5'-terminal, 0.2 g of 4 - {[(2S, 6R) -6- (4-benzamide-2-oxopyrimidin-1 (2H) -yl) -4-tritylmorfolin acid -2-yl] methoxy} 4-oxobutanoic supported on an aminopolystyrene resin (Reference example 1), acid 4 - {[(2S, 6R) -6- (5-methyl-2,4-dioxopyrimidine-1-yl ) -4- tritylmorpholin-2-yl] methoxy} -4-oxobutanoic supported on an aminopolystyrene resin (Reference example 2), acid 4 - {[(2S, 6R) -6- (6-benzamido purin-9- il) -4-tritylmorpholin-2-yl] methoxy} -4-oxobutanoic supported on an aminopolystyrene resin (Reference example 3), or 4 - {{((2S, 6R) -6- {6- (2- cyanoethoxy) -2 - [(2-phenoxyacetyl) amino] purin-9-yl} -4-tritylmorpholin-2-yl} methoxy} -4-oxobutanoic supported on an aminopolystyrene resin (Reference example 4), was filled in a column with a filter. Then, the synthetic cycle shown was started using an oligonucleotide synthesizer (AKTA Oligopilot 10 plus). The desired morpholino monomer compound was added to each coupling cycle to give the base sequence described in Table 1 (see Table 2 below). [TABLE 2]
Note: Steps 1, 2, 7 and 8 were performed again after the final cycle only in the case of 3'-terminal acetylation.
[00190] The unlocking solution used was a dichloromethane solution containing 3% (w / v) of trifluoroacetic acid. The neutralization and washing solution used was a solution obtained by dissolving N, N-diisopropylethylamine to be 10% (v / v) and tetrahydrofuran to be 5% (v / v) in dichloromethane containing 35% (v / v) ) acetonitrile. Coupling solution A used was a solution obtained by dissolving the morpholine monomer compound in tetrahydrofuran to be 0.10 M. The coupling solution B used was a solution obtained by dissolving N, N-diisopropylethylamine to be 20% (v / v) and tetrahydrofuran to be 10% (v / v) in acetonitrile. The leveling solution used was a solution obtained by dissolving 20% (v / v) of acetic anhydride and 30% (v / v) of 2,6-lutidine in acetonitrile.
[00191] The aminopolystyrene resin loaded with the previously synthesized PMO was recovered from the reaction vessel and dried at room temperature for at least 2 hours under reduced pressure. The dry PMO loaded in aminopolystyrene resin was loaded into a reaction vessel, and 5 mL of 28% ammonia water-ethanol (1/4) was added to it. The mixture was stirred at 55 ° C for 15 hours. The aminopolystyrene resin was filtered off and washed with 1 ml of water-ethanol (1/4). The resulting filtrate was concentrated under reduced pressure. The resulting residue was dissolved in 10 ml of a solvent mixture of 20 mM acetic acid - triethylamine buffer (TEAA buffer) and acetonitrile (4/1) and filtered through a membrane filter. The filtrate obtained was purified by reverse phase HPLC. The conditions used are as shown in Table 3 below. [TABLE 3]

[00192] Each fraction was analyzed, and the target product was recovered and concentrated under reduced pressure. To the concentrated residue was added 0.5 ml of 2M aqueous phosphoric acid solution, and the mixture was stirred for 15 minutes. In addition, 2 mL of 2 M aqueous sodium hydroxide solution was added to prepare the alkaline mixture, followed by filtration through a membrane filter (0.45 μm).
[00193] The resulting aqueous solution containing the target product was purified by an anion exchange resin column. The conditions used are as shown in Table 4 below. [TABLE 4]

[00194] Each fraction was analyzed (in HPLC) and the target product was obtained as an aqueous solution. To the resulting aqueous solution, 0.1 M phosphate buffer (pH 6.0) was added for neutralization. Then, the obtained mixture was desalted by reverse phase HPLC under the conditions described in Table 5 below. [TABLE 5]

[00195] The target product was recovered and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in water. The aqueous solution obtained was freeze-dried to give the target compound as a white cotton-like solid.
[00196] The calculated values and the values found for ESI-TOF-MS are represented in Table 6 below. [TABLE 6]


[1] TEST EXAMPLE In vitro assay
[00197] Using an L Amaxa Cell Line Nucleofector Kit in Nucleofector II (Lonza), 0.1 to 30 μM of the antisense oligomers in Table 1 were transfected with 3.5 x 105 of RD cells (human rhabdomyosarcoma cell line). Program T-030 was used.
[00198] After transfection, the cells were cultured for three nights in 2 mL of Eagle's minimum essential medium (EMEM) (manufactured by Sigma, then the same) containing 10% fetal bovine serum (FCS) (manufactured by Invitrogen ) under conditions of 37 ° C and 5% CO2.
[00199] The cells were washed once with PBS (manufactured by Nissui, then the same) and 350 μL of RLT buffer (manufactured by Qiagen) containing 1% 2-mercaptoethanol (manufactured by Nacalai Tesque) was added to the cells. After the cells were left to stand at room temperature for a few minutes to lyse the cells, the lysate was collected in a QIAshredder homogenizer (manufactured by Qiagen). Then, the lysate was centrifuged at 15,000 rpm for 2 minutes to prepare the homogenate. The total RNA was extracted according to the protocol attached to the RNeasy Mini Kit (manufactured by Qiagen). The concentration of the total extracted RNA was determined using a NanoDrop ND-1,000 (manufactured by LMS).
[00200] RT-PCR in one step was performed with 400 ng of the total RNA extracted using a QIAGEN OneStep RT-PCR Kit (manufactured by Qiagen). A reaction solution was prepared according to the protocol attached to the kit. PTC-100 (manufactured by MJ Research) or TaKaRa PCR Thermal Cycler Dice Touch (manufactured by Takara Bio) was used as a thermal circulator. The RT-PCR program used is as follows. 50 ° C, 30 mins: 95 ° C reverse transcription reaction, 15 mins: polymerase activation, reverse transcriptase inactivation, 94 ° C DNA denaturation, 30 seconds; 60 ° C, 30 seconds; 72 ° C, 1 min] x 35 cycles: PCR amplification 72 ° C, 10 mins: final extension
[00201] The base sequences of the forward and reverse primers used for RT-PCR are given below. Front starter: 5’- GCTCAGGTCGGATTGACATT -3 ’(SEQ ID NO: 125) Reverse starter: 5’- GGGCAACTCTTCCACCAGTA -3’ (SEQ ID NO: 126)
[00202] The reaction product, 1 μL of the previous PCR was analyzed using a Bioanalyzer (manufactured by Agilent Technologies, Inc.).
[00203] The level of polynucleotide "A" of the band with jump of exon 44 and the level of polynucleotide "B" of the band without jump of exon 44 were measured. Based on these “A” and “B” measurement values, the jump efficiency was determined by the following equation: Jump efficiency (%) = A / (A + B) x 100 Experimental results
[00204] The results are shown in figures 1 to 26. This experiment revealed that the oligomer of the present invention obtained by connecting short unitary oligomers selected from the 1st to the 44th bases (SEQ ID NO: 1) and the 58th to 115th bases (SEQ ID NO: 2), respectively, of the 5 'end of the exon 44 nucleotide sequence (SEQ ID NO: 10) in the human wild-type dystrophin gene effectively causes exon 44 to jump. [TEST EXAMPLE 2] In vitro assay
[00205] The experiment was carried out as in TEST EXAMPLE 1, except that 3.5 x 105 of RD cells (human rhabdomyosarcoma cell line) were transfected with the PMO Nos oligomers of the present invention. 34, 100, 45, 73, 49 and 47, each being alone or in the form where two unit oligomers that constitute each oligomer are contained alone or in mixture, at a concentration of 1, 3 or 10 μM, using an Amaxa Cell Line Nucleofector Kit L on Nucleofector II (Lonza). Program T-030 was used. The combinations of the sequences for transfection are as follows. [TABLE 7] Combination of transfected sequences
Experimental results
[00206] The results are shown in figures 27 to 31. This experiment revealed that each of the PMO Nos. 110 to 115, PMO No. 117 and PMO No. 118 that target a site in exon 44 could not cause exon 44 to jump itself. This experiment also revealed that, compared to mixtures of two antisense nucleic acids that target different sites in exon 44 (the mixture of PMO No. 114 and PMO No. 115; the mixture of PMO No. 109 and PMO No. 114; the mixture of PMO No. 110 and PMO No. 111; the mixture of PMO No. 112 and PMO No. 113; the mixture of PMO No. 117 and PMO No. 118; and the mixture of PMO No. 119 and PMO No. 120 ), the oligomers of the present invention of PMO No. 34, PMO No. 100, PMO No. 45, PMO No. 73, PMO No. 49 and PMO No. 47, where each of the corresponding unitary oligomers is connected to each other , cause exon 44 to jump with high efficiencies. [TEST EXAMPLE 3] In vitro assay using human fibroblasts
[00207] Exon 44 jumping activity was determined using GM05112 cells (patient with fibroblasts derived from human DMD with exon 45 deletion, Coriell Institute for Medical Research). As a growth medium, Dulbecco's modified Eagle medium was used: N-nutrient mixture F-12 (DMEM / F-12) (Life Technologies) containing 10% FCS (HyClone Laboratories, Inc.) and 1% Penicillin / streptamycin ( P / S) (Sigma-Aldrich, Inc.) and the cells were grown under conditions of 37 ° C and 5% CO2.
[00208] The cells were cultured in a T225 flask and the 2.5 mL retrovirus (coexpression ZsGreen1) expressing human-derived myoD (SEQ ID NO: 127) and a final concentration of 8 μg / mL polybrene (Sigma-Aldrich , Inc.) was added to 30 ml of the growth medium. After incubation at 32 ° C for 2 days, the medium was exchanged for a freshly prepared growth medium and further incubation continued at 37 ° C for 3 days. Fibroblasts transformed by MyoD positive for ZsGreen1 were collected by BD FACSAria Cell Sorter (BD Bioscience). The collected cells were suspended in a differentiation medium (DMEM / F-12 containing 2% equine serum (LifeTechnologies), 1% P / S and ITS liquid medium supplement (Sigma-Aldrich, Inc.)) and plated at 9.4 x 104 cells / well in a 24-well plate coated with collagen. The medium was changed every 2 to 3 days and incubation continued to differentiate into myotubes.
[00209] On the 7th day after plating on a 24-well plate, the medium was replaced with a differentiation medium and 10 μM of PMO oligomers No. 34, 45, 49 and 73 were added to it at a final concentration. After the cells were incubated for 2 days, the medium was replaced with a differentiation medium without PMO, and the cells were incubated for another five days. Then, the cells were collected to extract total RNA using Mini Kit RNeasy (QIAGEN). RT-PCR was performed with 50 ng of the total RNA extracted using a QIAGEN OneStep RT-PCR Kit. A reaction solution was prepared according to the protocol attached to the kit. An iCycler (manufactured by Bio-Rad Laboratories) was used as a thermal circulator. The RT-PCR program used is as follows. 50 ° C, 30 mins: 95 ° C reverse transcription reaction, 15 mins: polymerase activation, reverse transcriptase inactivation, 94 ° C DNA denaturation, 1 min; 60 ° C, 1 min; 72 ° C, 1 min] x 35 cycles: PCR amplification 72 ° C, 7 mins: final extension
[00210] The base sequences of the forward and reverse primers used for RT-PCR are given below. Front starter: 5’- GCTCAGGTCGGATTGACATT -3 ’(SEQ ID NO: 125) Reverse starter: 5’- GGGCAACTCTTCCACCAGTA -3’ (SEQ ID NO: 126)
[00211] 1 μL of PCR product was analyzed by Analysis Kits from Experion DNA 1K (Bio-Rad Laboratories) using Experion Electrophoresis Station (Bio-Rad Laboratories). DNA 1K assay was selected in version 3.2 of the Software Experion (Bio-Rad Laboratories) and measured. The level (a) of the band around 317 bp and the level (B) of the band around 465 bp were determined (unit: nmol / L). The jump efficiency (%) was determined by the following equation using Excel 2007 SP3 (Microsoft). Jump efficiency (%) = A / (A + B) x 100 Experimental results
[00212] The results are shown in FIGURE 32. This experiment revealed that the antisense oligomers of the present invention of PMO Nos.34, 45, 49 and 73 could cause the exon 44 to jump with a high efficiency in cells of a patient with DMD with exon 45 deletion. INDUSTRIAL APPLICABILITY
[00213] Experimental results in the TEST EXAMPLES demonstrate that the oligomers of the present invention, in which short oligomers are connected, caused the exon 44 to jump in RD cells. In this way, the oligomers of the present invention are extremely useful for the treatment of DMD.
[00214] Free text of the sequence listing

权利要求:
Claims (11)
[0001]
1. Anti-sense oligomer, characterized by the fact that it is a nucleotide sequence selected from the group consisting of SEQ ID NOs: 6 to 9, and induces a jump from exon 44 in the human dystrophin gene, or a pharmaceutically acceptable salt or hydrate thereof.
[0002]
An antisense oligomer according to claim 1, characterized in that it is an oligonucleotide or a pharmaceutically acceptable salt or hydrate thereof.
[0003]
An antisense oligomer according to claim 2, characterized in that the sugar fraction and / or the phosphate-binding region of at least one nucleotide that constitutes the oligonucleotide is modified, or a pharmaceutically acceptable salt or hydrate thereof. .
[0004]
An antisense oligomer according to claim 2 or 3, characterized in that the sugar fraction of at least one nucleotide that constitutes the oligonucleotide is a ribose in which the 2'-OH group is replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br and I (where R is an alkyl or an aryl and R 'is an alkylene), or a pharmaceutically acceptable salt or hydrate thereof.
[0005]
An antisense oligomer according to any one of claims 2 to 4, characterized in that the phosphate-binding region of at least one nucleotide that constitutes the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond and a boranophosphate bond, or a pharmaceutically acceptable salt or hydrate thereof.
[0006]
An antisense oligomer according to claim 1, characterized in that it is a morpholino oligomer, or a pharmaceutically acceptable salt or hydrate thereof.
[0007]
An antisense oligomer according to claim 6, characterized in that it is a phosphoramidate morpholino oligomer, or a pharmaceutically acceptable salt or hydrate thereof.
[0008]
An antisense oligomer according to claim 6 or 7, characterized in that the 5 'end is any of the chemical formulas (1) to (3) below, or a pharmaceutically acceptable salt or hydrate thereof. [Formula 26]
[0009]
9. Pharmaceutical composition for the treatment of muscular dystrophy through the exon 44 jump in the human dystrophin gene, characterized by the fact that it comprises, as an active ingredient, the antisense oligomer as defined in any of claims 1 to 8, or a salt or pharmaceutically acceptable hydrate thereof.
[0010]
Pharmaceutical composition according to claim 9, characterized in that it comprises a pharmaceutically acceptable carrier.
[0011]
11. Use of an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof as defined in any one of claims 1 to 8, characterized in that it is for the manufacture of a pharmaceutical composition for treating muscular dystrophy.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112016029369B1|2020-12-08|antisense oligomer, pharmaceutical composition use of an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof, and methods for making and screening an antisense oligomer

---

JP2019062913A|2019-04-25|Antisense nucleic acid

---

US11053497B2|2021-07-06|Antisense nucleic acids

---

JP2022033738A|2022-03-02|Antisense nucleic acid

---

AU2020200679B2|2022-03-10|Antisense nucleic acids

同族专利:

---

公开号 | 公开日

---

EP3660154A1|2020-06-03|

---

AU2021203383A1|2021-06-24|

---

CO2017000357A2|2017-06-09|

---

IL249574D0|2017-02-28|

---

NZ728103A|2021-11-26|

---

SI3159409T1|2020-02-28|

---

PL3159409T3|2020-05-18|

---

AU2015277924A1|2017-02-02|

---

EP3159409A4|2018-01-10|

---

DK3159409T3|2020-01-27|

---

CN106661577B|2020-05-12|

---

RU2017101172A|2018-07-17|

---

CN106661577A|2017-05-10|

---

EP3159409A1|2017-04-26|

---

US11193125B2|2021-12-07|

---

ZA201700142B|2020-05-27|

---

JP6701139B2|2020-05-27|

---

LT3159409T|2020-01-27|

---

KR20170017939A|2017-02-15|

---

UA121117C2|2020-04-10|

---

TW201936922A|2019-09-16|

---

RU2017101172A3|2018-12-24|

---

AU2015277924B2|2021-02-25|

---

SG11201610130VA|2017-01-27|

---

EP3159409B1|2019-12-04|

---

WO2015194520A1|2015-12-23|

---

US20220049257A1|2022-02-17|

---

CN111575282A|2020-08-25|

---

MX2016016526A|2017-04-04|

---

CA2951221A1|2015-12-23|

---

PH12016502501A1|2017-03-22|

---

JP6208349B2|2017-10-04|

---

SG10201912858VA|2020-02-27|

---

JP2020182459A|2020-11-12|

---

TWI721461B|2021-03-11|

---

BR112016029369A2|2018-01-09|

---

JPWO2015194520A1|2017-04-20|

---

RU2695430C2|2019-07-23|

---

PT3159409T|2020-01-21|

---

JP2018027087A|2018-02-22|

---

US9840706B2|2017-12-12|

---

TWI666317B|2019-07-21|

---

US20180044675A1|2018-02-15|

---

RS59764B1|2020-02-28|

---

KR102335810B1|2021-12-03|

---

HUE047502T2|2020-04-28|

---

US20170204410A1|2017-07-20|

---

HRP20200042T1|2020-03-20|

---

IL249574A|2021-02-28|

---

RU2019121781A|2019-07-22|

---

ES2765463T3|2020-06-09|

---

TW201625274A|2016-07-16|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

WO1991009033A1|1989-12-20|1991-06-27|Anti-Gene Development Group|Uncharged morpholino-based polymers having phosphorous-containing chiral intersubunit linkages|

---

JP2924179B2|1993-02-19|1999-07-26|日本新薬株式会社|Glycerol derivatives, devices and pharmaceutical compositions|

---

FR2705361B1|1993-05-18|1995-08-04|Centre Nat Rech Scient|Viral vectors and use in gene therapy.|

---

EP2530155B1|2002-11-25|2016-03-16|Masafumi Matsuo|ENA nucleic acid drugs modifying splicing in mRNA precursor|

---

CA2524255C|2003-03-21|2014-02-11|Academisch Ziekenhuis Leiden|Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure|

---

PT1766010E|2004-06-28|2011-05-25|Univ Western Australia|Antisense oligonucleotides for inducing exon skipping and methods of use thereof|

---

EP1857548A1|2006-05-19|2007-11-21|Academisch Ziekenhuis Leiden|Means and method for inducing exon-skipping|

---

JP5143450B2|2007-03-14|2013-02-13|斉 大戸|New alleles in HLA-B locus|

---

EP2203173B1|2007-10-26|2015-12-23|Academisch Ziekenhuis Leiden|Means and methods for counteracting muscle disorders|

---

EP2207779B1|2007-11-15|2014-04-09|Sarepta Therapeutics, Inc.|Method of synthesis of morpholino oligomers|

---

EP2119783A1|2008-05-14|2009-11-18|Prosensa Technologies B.V.|Method for efficient exon skipping in Duchenne Muscular Dystrophy and associated means|

---

US8084601B2|2008-09-11|2011-12-27|Royal Holloway And Bedford New College Royal Holloway, University Of London|Oligomers|

---

EP2350281B1|2008-10-24|2014-05-14|Sarepta Therapeutics, Inc.|Multiple exon skipping compositions for dmd|

---

NZ595955A|2009-04-24|2012-10-26|Prosensa Technologies Bv|Oligonucleotide comprising an inosine for treating dmd|

---

EP2499249B1|2009-11-12|2018-08-08|The University Of Western Australia|Antisense molecules and methods for treating pathologies|

---

TWI541024B|2010-09-01|2016-07-11|日本新藥股份有限公司|Antisense nucleic acid|

---

EP2672977A1|2011-02-08|2013-12-18|The Charlotte-Mecklenburg Hospital Authority d/b/a Carolina Healthcare System|Antisense oligonucleotides|

---

CN108588073A|2011-12-28|2018-09-28|日本新药株式会社|antisense nucleic acid|

---

CN111893117A|2012-01-27|2020-11-06|比奥马林技术公司|RNA-regulated oligonucleotides with improved properties for the treatment of duchenne muscular dystrophy and becker muscular dystrophy|

---

CN110257379A|2012-07-03|2019-09-20|马林生物科技有限公司|For treating the oligonucleotides of muscular dystrophy patient|

---

JP2014124157A|2012-12-27|2014-07-07|Nihon Cornstarch Corp|Coffee drink|

---

TWI666317B|2014-06-17|2019-07-21|Nippon Shinyaku Co., Ltd.|Antisense nucleic acid|TWI666317B|2014-06-17|2019-07-21|Nippon Shinyaku Co., Ltd.|Antisense nucleic acid|

---

KR101968880B1|2015-09-15|2019-04-12|니뽄 신야쿠 가부시키가이샤|Antisense nucleic acids|

---

WO2017047741A1|2015-09-16|2017-03-23|日本新薬株式会社|Antisense nucleic acid for treating amyotrophy|

---

KR20180056766A|2015-10-09|2018-05-29|웨이브 라이프 사이언시스 리미티드|Nucleotide compositions and methods thereof|

---

MA45328A|2016-04-01|2019-02-06|Avidity Biosciences Llc|NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND USES THEREOF|

---

EP3478697A1|2016-06-30|2019-05-08|Sarepta Therapeutics, Inc.|Exon skipping oligomers for muscular dystrophy|

---

JP2020503010A|2016-12-19|2020-01-30|サレプタ セラピューティクス， インコーポレイテッド|Exon skipping oligomer conjugates for muscular dystrophy|

---

US10888578B2|2016-12-19|2021-01-12|Sarepta Therapeutics, Inc.|Exon skipping oligomer conjugates for muscular dystrophy|

---

EA201991450A1|2017-09-22|2019-12-30|Сарепта Терапьютикс, Инк.|OLIGOMER CONJUGATES FOR EXONISM SKIP IN MUSCULAR DYSTROPHY|

---

MA51582A|2016-12-19|2019-10-23|Sarepta Therapeutics Inc|OLIGOMERIC CONJUGATES OF EXON JUMPING FOR MUSCLE DYSTROPHY|

---

JP2020505330A|2017-01-06|2020-02-20|アビディティー バイオサイエンシーズ エルエルシー|Nucleic acid polypeptide compositions and methods for inducing exon skipping|

---

GB201711809D0|2017-07-21|2017-09-06|Governors Of The Univ Of Alberta|Antisense oligonucleotide|

---

KR20200060443A|2017-09-22|2020-05-29|어비디티 바이오사이언시스 인크.|Nucleic acid-polypeptide compositions and methods of inducing exon skipping|

---

KR20200097751A|2017-12-06|2020-08-19|어비디티 바이오사이언시스 인크.|Compositions and methods for treating muscular dystrophy and muscular dystrophy|

---

US10758629B2|2018-05-29|2020-09-01|Sarepta Therapeutics, Inc.|Exon skipping oligomer conjugates for muscular dystrophy|

---

US11168141B2|2018-08-02|2021-11-09|Dyne Therapeutics, Inc.|Muscle targeting complexes and uses thereof for treating dystrophinopathies|

---

US20220025368A1|2018-11-02|2022-01-27|Biomarin Technologies B.V.|Bispecific antisense oligonucleotides for dystrophin exon skipping|

法律状态:
2019-10-08| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2020-03-10| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2020-07-21| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2020-07-28| B15K| Others concerning applications: alteration of classification|Free format text: AS CLASSIFICACOES ANTERIORES ERAM: C12N 15/113 , A61K 31/712 , A61K 31/7125 , A61K 48/00 , A61P 21/04 Ipc: C12N 15/113 (2010.01), A61K 31/712 (2006.01), A61K |

---

2020-11-03| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2020-12-08| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 16/06/2015, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

JP2014124157|2014-06-17|

---

JP2014-124157|2014-06-17|

---

PCT/JP2015/067238|WO2015194520A1|2014-06-17|2015-06-16|Antisense nucleic acid|

---